Tonight's mystery is a straight-up Name That Bug:
From central Florida, the mystery insect
One point for picking the order, two points for family, five points for genus, and five points for species. [added in edit- you've got to be first in any one category].
And guess what? We've finally decided what to do with all these hard-earned Myrmecos Points!
At the end of every month, I'll tally points from the preceding weeks and the winner will get to choose either:
- Any 8x10 print from the galleries of www.alexanderwild.com
-or, since so many of you are bloggers-
- A freebie blog entry where the winner may use Myrmecos Blog to guest post on a topic of their choosing, provided it is reasonably Safe for Work.
This week's results will be carried into April's tally.
- Log in to post comments
More like this
[note: this and all preceding entries are reposted from myrmecos.wordpress.com; guesses for this Monday Night Mystery are also lodged here.]
What in the world is this strange creature?
The point breakdown* will be as follows:
2 points for order
2 points for family
2 points for genus
2 points for…
Ok. Now you guys have asked for it. Apparently the mysteries haven't been quite obscure enough.
So here you go. A real challenge:
One point for order, three points for family, three points for genus, and three for species. Points are awarded for the first correct guess in each category.
The…
Tonight's mystery* takes us down into the magical world of scanning electron microscopy.
Five points for picking the organism and five for picking the structure. As usual, only the first correct answer in each category collects the points.
The cumulative points winner for the month of April gets…
This week we delve into the genes of the mystery organism. Here's a short snippet of DNA:
ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA
5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene…
Hemiptera Flatidae Ormenaria sp?
Looks like Ormenaria rufifascia.
rufifascia?
That'll teach me to refresh.
Flatidae: Ormenaria rufifascia (Walker),
Dangit, I didn't see you guys had it already.
Suborder bonus point?? - Auchenorrhyncha
!
Oooh, if we're playing that game, then:
Infraorder: Fulgoromorpha
Superfamily: Fulgoroidea
:-p
Aw, darn it, if only I didn't forget to check right after school today again.
Anyway, I'll throw my hat in the Ormenaria rufifascia ring.
Oh wait, Order Hemiptera. That's at least 1 point, right? (please?)
Fig. 1. Ormenaria rufifascia Walker, 1851 (Hemiptera: Flatidae), lateral view.
:)