Alex Wild
awild
Posts by this author
April 19, 2010
Tonight's mystery* takes us down into the magical world of scanning electron microscopy.
Five points for picking the organism and five for picking the structure. As usual, only the first correct answer in each category collects the points.
The cumulative points winner for the month of April gets…
April 19, 2010
Today, it's the New York Times. Consider this Q & A:
Q. Can the tiny ants that visit me every spring hop like a flea? Sometimes I look down and suddenly there one is, working its way across my anatomy.
A. It is possible. Several of the estimated 10,000 to 14,000 identified species of ant are…
April 19, 2010
Strumigenys rogeri in the leaf litter
In 1982, a small journal called The Coleopterists Bulletin carried a two page note by beetle expert Terry Erwin that increased- by an order of magnitude- the estimated number of species on the planet. Erwin crunched some back-of-the-napkin numbers based on the…
April 18, 2010
If ants were to drop acid I'm not sure what they'd experience. But this entrancing short film by Jörg Brönnimann is as good a guess as any:
ant-views from Jörg Brönnimann on Vimeo.
April 17, 2010
Polistes dominula, the European Paper Wasp
captured with an iPhone
As an insect guy, the first question I ask about any camera is: Can I shoot bugs with it?
To my great disappointment, the answer for most cell phones is no. Cell phone cameras are normally fixed to focus at distances useful for…
April 16, 2010
Philothermus glabriculus (Cerylonidae)
Urbana, Illinois
A while back I noted that, at a rate of one beetle per week, I'd need about 10,000 years to get through all the described species. Since I made that comment we're getting closer to needing only 9,999 years, but if the Coleopterists keep…
April 15, 2010
The downside to a celebrated and prolific scientific career is that you generate enough of a paper trail for something you concluded, somewhere, to be erroneous.
I happened on an amusing example this week while photographing the Caribbean turtle ants I blogged about earlier. Like most of the world…
April 14, 2010
I would be remiss in my duties as an ant blogger to not pass this on from NCBI ROFL:
Transcultural sexology: formicophilia*, a newly named paraphilia in a young Buddhist male.
*The sexual interest in being crawled upon or nibbled by small insects, such as ants
Abstract: Children whose species-…
April 14, 2010
...for no reason other than that I need something sparkly this morning.
Temnoscheila sp. bark-gnawing beetle, Trogossitidae
Tucson, Arizona
The reflective integument makes this beetle a real trick to shoot. It's like trying to photograph a mirror- a regular flash either reflects back at full,…
April 13, 2010
What was that inexplicable bit of chitin hiding away in a hole in a twig?
This photo should help:
It's the heavily sclerotized head shield of a Cephalotes varians turtle ant. Ants in this mostly Neotropical genus inhabit pre-existing cavities in trees and branches, a limiting resource that spurs…
April 13, 2010
The winners of the NCSU insect blog Hexapod Haiku Challenge have been announced. Here's the best in show:
Major, Undeclared
Silverfish, tell me,
Darwin and Dostoevsky,
do they taste the same?
-Martha Love
Gastonia, NC
Ha! I love it.
April 12, 2010
For a second time, that is. Some of you may remember me from Photo Synthesis, where I guest blogged for a bit a year ago. I am happy to be invited back to the borg!
Myrmecos is not a new blog. Rather, we have been over at Wordpress since 2007. I say "we", because the blog has evolved to become…
April 12, 2010
[note: this and all preceding entries are reposted from myrmecos.wordpress.com; guesses for this Monday Night Mystery are also lodged here.]
What in the world is this strange creature?
The point breakdown* will be as follows:
2 points for order
2 points for family
2 points for genus
2 points for…
April 12, 2010
A few days ago I posted a photo of a Prenolepis ant queen. It's a decent photo, in focus and properly exposed. But probably not anything I'd print out and hang on the wall.
Check out the monochrome version above, though (click on it to enlarge). I don't often put my images through such severe…
April 9, 2010
Penthe pimelia (Tetratomidae)
Illinois, USA
A couple years back I was working on the Beetle Tree of Life project as a molecular phylogeneticist. My main responsibility was to gather DNA sequence data for several hundred beetles distributed across the spectrum of Coleopteran diversity.
As I'm not…
April 7, 2010
Wasmannia auropunctata - little fire ants Buenos Aires, Argentina
One of the world's worst invaders, the little fire ants have spread from the new world tropics to warmer regions around the globe, becoming especially problematic on oceanic islands. The ants above, though, are from an innocuous…
April 7, 2010
If you've been following the Taxonomy Fail and subsequent Myrmecology Win, you'll know that the real Fail was my own. That blurry mash of legs and cuticle is indeed an ant, and I missed it.
That I failed to discern an ant in the original image doesn't bother me. After all, the photo was the…
April 6, 2010
Plega sp. (Mantispidae)
Who was the source of Monday's DNA? As many of you discerned from the online Genbank database, the sequence came from Plega dactylota, a Neuropteran insect in the family Mantispidae.
10 points to Aaron Hardin, who guessed it first.
For future reference, these genetic…
April 6, 2010
Well. Raising a holy hullabaloo on the internet pays dividends. Vincent Perrichot, one of the authors on the contested PNAS paper, has sent along another aspect of the mystery fossil:
Having trouble? I've arranged a Formica specimen to model the pose:
In the comments below, Vincent provides his…
April 5, 2010
In a change of pace, tonight's mystery is for the bioinformaticians. Here's some DNA sequence:
ACGAAATCGGCGAGAAAGTCGCGCCCAGCGCCGCTGTTTACTCGATTCAGGAAGCCCTGGACGCCGCAGA
What sort of organism did it come from?
Ten points to the first person who can pick the genus.
April 5, 2010
Today's breaking news in Ant Science is this:
Newly discovered pieces of amber have given scientists a peek into the Africa of 95 million years ago, when flowering plants blossomed across Earth and the animal world scrambled to adapt.
Suspended in the stream of time were ancestors of modern spiders…
April 5, 2010
[a guest post by myrmecologist Andrea Lucky]
Andrea & her intrepid field team in New Guinea
It was a dark and stormy night...
...actually, it was a dark and stormy morning. The dawn of the 7th day of ceaseless frigid rain to be precise, and I was reminiscing about the grand old days one week…
April 4, 2010
Prenolepis imparis - winter ant (queen)
Urbana, Illinois
Photo details: Canon mp-e 65mm 1-5x macro lens on a Canon EOS 50D
ISO 100, f13, 1/250 sec, diffused flash
April 3, 2010
We're hosting a party for the roller derby girls, so I'm otherwise preoccupied today. Help yourself to some links, though:
Mark Moffett, the quintessential National Geographic bug photographer, has a new ant book.
Margaret Atwood (yes, that Margaret Atwood), reviews E. O. Wilson's novel.
Carl…
April 2, 2010
Dendroides fire-colored beetle,
Illlinois
We in the Friday Beetle Department don't often turn our attention to immature beetles. But these Dendroides larvae are too striking to pass up.
Dendroides fire-colored beetles inhabit the flat, two-dimensional space under the bark of dead trees. The…
April 1, 2010
Myrmicocrypta camargoi Sosa-Calvo & Schultz 2010
Brazil
The world's ant fauna continues to yield new treasures. Myrmicocrypta camargoi, described in a new paper by Jeffrey Sosa-Calvo & Ted Schultz, is the largest species in this fungus-growing genus.
source: Sosa-Calvo, J., Schultz, T.R…
March 31, 2010
Leptomyrmex darlingtoni, Australia
A big day for ant evolution! The Ant Tree of Life research group (AToL) has published their dolichoderine phylogeny in the journal Systematic Biology.
Dolichoderines are one of the big ant subfamilies, comprising just under ten percent of the world's ant species…
March 31, 2010
Hippodamia sp. Ladybird beetle
Tucson, Arizona
Photo details: Canon 100mm f2.8 macro lens on a Canon EOS 20D
ISO 100, f4.5, 1/320 sec, ambient light