mystery
dr. dolittle | January 8, 2014 Frog with an extra foot. Image from the Minnesota Pollution Control Agency.
Image of a frog with a missing leg from the Minnesota Pollution Control Agency.
Since 1995 deformed frogs have been turning up. Call them the canaries in the coal mine for environmental health. Frogs are showing signs of some kind of stress.
So is it a parasite? Pollution? A natural phenomenon? Cannibalism? Fungus? Ultraviolet light? Something in the water?
Video from YouTube
The tap water data referred to in the video in which they placed embryos in tap water collected from different sites in Minnesota…
dr. dolittle | December 19, 2013Could giant freshwater octopuses really be to blame for the many unexplained drownings in Oklahoma's lakes?
sciencepunk | August 31, 2011My folks have a pear tree at the end of the garden. It never really produces much in the way of fruit - I think it's too close to the much bigger apple tree. I found this pear lying on the ground in some long grass. It has a weird pattern of holes made in a perfect spiral along the fruit. What happened?
awild | April 26, 2010
This week we delve into the genes of the mystery organism. Here's a short snippet of DNA:
ATGTCGCGTATCATGGAAAAGGAAAACATCACCGAAAATCTGGAAAAGATTTCCATCAAGAATGCTCGTA
5 points for the first person to pick the genus and species, and 5 points to the first person who can explain why this particular gene was targeted for study.
I'll post the answer tomorrow. Since we've reached the end of the month, I'll tally all the points from the preceding mysteries and announce the March/April mystery winner, who is entitled to either 1) any 8 x 10 print from my photo galleries, or 2) a guest blog slot on any (…
sciencepunk | March 12, 2010A few weeks ago I was given a vintage camera that turned out to have a film hidden inside. On developing, I found the entire roll was dedicated to pictures of an old gravesite.
Who was Edward Langan? Why had he been added to a grave with a man called James Ryan? And why (as the film dates from 1973) is the grave covered in flowers when the pictures were taken several years afer their deaths?
All these questions, and more, answered after the fold.
Outfoxed, I turned to the Liverpool & South West Lancs Genealogy Forums for help. They proved to be absolutely incredible at tracking down…
awild | March 8, 2010Alright, Sherlock. What's going on here?
Five points each for the identity of the big round thing, for the insect at the top, and for the insect at the side. Ten points for describing the story.
And a freebie point to anyone who comes up with an idea for what to do with all these points.
This scene was photographed in the fall in southern Illinois. Here are close-ups of the critters:
mystery wasp #1
mystery wasp#2
bcohen | September 4, 2009I had the chance to interview Rebecca Solnit for The Believer. It's on shelves now, in their September issue. They've also put the full text of it on-line at their website. (Here it is.)
To quote the interview's intro, Solnit is the author of twelve books. She is a journalist, essayist, environmentalist, historian, and art critic; she is a contributing editor to Harper's, a columnist for Orion, and a regular contributor to Tomdispatch.com and The Nation; she's also written for, among other publications, the L.A. Times, the San Francisco Chronicle, and the London Review of Books.
She talks…
awild | June 29, 2009I hadn't anticipated that my keen readers would try to guess the *species* of the aforementioned oddity, but since the guessing has headed in that direction I'll post this hint, which shows the much more commonly seen worker caste of our little mystery bug.
Stakes are now at, um, 15 points. Yeah.
awild | June 27, 2009
This odd little beast crawled out of a leaf litter sample from a mesic oak/pine forest in Florida. Ten points to the first person who picks what it is.
(Not sure what you'll do with ten points. But hey. You're all a creative lot.)
awild | May 20, 2009
I photographed this weird...sluggy thing, I guess you could say, in an ant nest in subtropical Argentina.Â
Ten points to the first person who picks what it is.
sciencepunk | May 18, 2009The Sun and Mail are reporting the discovery of a mystery beast washed ashore in North Devon, speculating that it could be the fabled Beast of Exmoor. By most accounts, the Beast of Exmoor is a big cat such as a puma that escaped or was released onto the remote moors in the 1970s and has lived there ever since, preying on livestock. No real evidence has ever been found, save blurry photographs and unconfirmed sightings. The Sun reported this new development:
The Sun rubbishes claims that this might be a seal, pointing out: "The Marine Conservation Society and the National Seal Sanctuary…
cwilcox | February 25, 2009I thought I'd try to build some suspense for a future post (that, and I want an excuse to post some nice pictures). So, I'll just leave you with these clues:
1. Tom Selleck.2. A heart the size of a mini-cooper.
And these images:
What am I going to write about? You'll have to see... or go ahead, try to guess!
Which also reminds me, in general. Check out the footer to my posts - I successfully added some "reactions" and "ratings". It'll make me feel a whole lot more special if people use them!